Awakening Edna Essays: Free Topic, Sample and Examples

1a) Biometric for e-Voting in the UKBiometric identification involves identifying individuals by their human characteristics as opposed to other modern methods of identification such as passwords, identification cards, passports etc. There are different technologies used to make such identifications. The accuracy of the different technologies available in the market vary greatly in the type of human characteristic such as voice, finger prints, body shape etc that they seek to identify. There are ...
Read Text
Biological Diversity - Viruses
The paper “Biological Diversity - Viruses”  is an outstanding variant of a  literature review on biology. Tortora et al (2013) describe microorganisms as living organisms that are so small the human being cannot see them with the naked eye. A special device called a microscope, which magnifies the size of an image to beyond a hundred times its size, is required to view them. Microorganisms, also known as microbes, are responsible for many diseases that plague the human body. ...
Read Text
Breast MRI 7017
Breast MRIQ 1Hormonal influences on breast tissue during the normal menstrual cycle:Breast tissue is a complicated arrangement of tissues that are closely tied to blood vessels, fatty tissues and nerves. These tissues are built in the mammary glands. There are two hormones that are produced by the ovary which have influence on the breast tissue during the menstrual cycle, oestrogen and progesterone.When monthly cycle starts the level of blood oestrogen do rise. The rise of oestrogen causes the breast ...
Read Text
Managing a Human Immunodeficiency Virus Positive Patient
The paper "Managing a Human Immunodeficiency Virus Positive Patient" is a perfect example of a case study on category. Statistics says by 2001, 40 million people were living with HIV /AIDS and more than 20 million had already died of AIDS, with above half of all new HIV infection was found to occur among young people, found to be increased from 3.9% in 1999 to 4.2 % in 2004. (Centers for Disease Control and Prevention. HIV/AIDS Surveillance Report, 2004. Accessed March 7, 2004.). Outline of the ...
Read Text
Discuss How Post-translational Modification Alters Protein Function In Human Biological Systems
Proteins are of great importance to the human biological system as they play a wide range of functional and structural roles. Proteins are known to for the basic organic basis of various structures of the human system such as the hair, muscles, tendons, cartilage and the skin. All the catalysts that are found in the biochemical transformations and the enzymes too are protein in nature not forgetting hormones such as insulin and the hormones that are responsible for growth. The cytochromes and Hemoglobin ...
Read Text
Recent Advances In Novel Food Preservation Technique
IntroductionFood preservation basically is the exposure of pathogens and spoilage microbes to a hostile environment in order to slow down their growth or shorten their continued existence or cause their instant death. The reaction of microbes to these environments validates whether they survive or die. For us to understand these reactions a lot of research needs to be carried out. Some scholars have undertaken the study of these microorganisms considering their homeostasis, metabolic disintegration ...
Read Text
Sociological Concepts and Theories to Contemporary Health Issues in Australia
The paper "Sociological Concepts and Theories to Contemporary Health Issues in Australia" is a good example of a sociology essay. There is a notion in many societies of hunting and gathering that men hunt while women gather. The states in which society men and women perform or are allocated different jobs is what is known as the sexual division of labour or in other terms gender division of labour (Peoples, and Bailey, 2011). We can summarize the principles of the sexual division of labor in a society, ...
Read Text
Kate Chopins The Awakening
The paper "Kate Chopin’s The Awakening" is an outstanding example of a book review on English.Kate Chopin’s “The Awakening” has a remarkable use of language that helps present its themes. This forum presents a close reading of the last passage in chapter one, which says, “Coming back to dinner?” his wife called after him. He halted a moment and shrugged his shoulders. He felt in his breast-pocket; there was a ten-dollar bill there. He did not know; perhaps he would ...
Read Text
Contemporary American Foreign Policy
The paper "Contemporary American Foreign Policy" is a wonderful example of a political case study. A closer look at the United States foreign policy contemporarily leaves a lot that has been desired the world over, whereas some policies have been criticized in spirit and letter. In the study, we focus on how the US has in the past few years conducted its business and its general behavior towards other nations of the world. These range from issues directly affecting it or in some cases, its allies ...
Read Text
Multiculturalism in Australia
The paper "Multiculturalism in Australia" is a great example of a case study on sociology. The concept of the nation-state in modern-day usage is evolved from its earlier usage, where the nation-state today comprises a number of elements, including the economic, social, global and political aspects of functioning. The state today in the modern era performs a number of functions, due to the reason that most of the aspects of the country need to be regulated by the state. The state usually regulates ...
Read Text
The Nucleotide Sequence of DNA, Introns & Exons, Restriction Enzymes, Intron-Exon Evolution, cDNA Sequencing, Estimating Gene
The paper “The Nucleotide Sequence of DNA, Introns & Exons, Restriction Enzymes, Intron-Exon Evolution, cDNA  Sequencing, Estimating Gene Numbers” is a meaty example of an assignment on biology. A dideoxynucleotide sequencing gel obtained from the beginning of a certain DNA segment is shown below. The nucleotide sequence of this DNA section is 5’GAACATCAGGATCGTACCAGGGTAA3’ .2INTRONS & EXONS(note: single loop lying under molecule shown)(a) According to the figure, ...
Read Text
DNA Lab Report
AbstractThe purity and integrity of RNA isolated from tissue or cultured cells are critical for its successful use in applications such as reverse transcription PCR (RT-PCR), real-time PCR, RNase protection assays, Northern blot analysis, oligo (dT) selection of poly (A) + RNA, in vitro translation and micro array analysis. In the current years, a powerful technique that is used to recognize and measure quantitate definite mRNAs from little amounts of total RNA and mRNA, RT-PCR has come out. Te requirement ...
Read Text
Polymerase Chain Reaction as a Method of DNA Fingerprinting
The paper "Polymerase Chain Reaction as a Method of DNA Fingerprinting" is a great example of a lab report on biology. The processes used here is for detecting the presence of matching DNA fragments from four suspects who broke into a house. After the DNA found at the scene of the crime is tested, it formed a line and when the DNA tests of the suspects are performed, they are compared to the marker line which is the DNA sample from the crime scene. Whichever matches it, the suspect is guilty of the ...
Read Text
Introduction to Microbial Genetics, Quantitation of DNA, Restriction Digestion and Agarose Gel Electrophoresis
The paper “Introduction to Microbial Genetics, Quantitation of DNA, Restriction Digestion and Agarose Gel Electrophoresis” is a meaty example of a lab report on biology. Cell walls and membranes must be broken to release the DNA and other intracellular components through a process called cell lysis. Therefore, lysis of the bacterial cell can also be achieved with a proper combination of an enzyme called lysozyme to digest the cell wall and detergents to disrupt membranes. The ionic detergent ...
Read Text
Gene Expression Levels of csy1 Gene
Lab Summary on Gene Expression Levels of csy1 Gene Introduction The science of measuring expression of a gene is a widely practiced technique in molecular biology. The technique is therefore when a snapshot is taken of the cell’s physiology under certain particular conditions. It is a practical thing that organisms contain genes. The genes are actually the specific regions on the chromosome and give particular instructions on how to make products. Most of the time, this product is a protein. Hundreds ...
Read Text
Cleaning the Thermostable DNA Polymerase from Taq Polymerase Using the Latter to Enhance the Target Gene to Match the Unknown
The paper “Cleaning the Thermostable DNA Polymerase from Taq Polymerase Using the Latter to Enhance the Target Gene to Match the Unknown Entity” is an informative variant of a lab report on biology. The aim of this practical was to express and purify the thermostable DNA polymerase from Thermophilus aquatics using this Taq polymerase to amplify the target gene to identify the unknown organism.The polymerase chain reaction (PCR) is a tool that is used to amplify DNA, where at every thermal ...
Read Text
Process of DNA Replication
The paper "Process of DNA Replication" is an excellent example of coursework on biology. DNA is an abbreviation for deoxyribonucleic acid. It is formed by polymerization of nucleotides. Nucleotides are composed of deoxyribose sugar, nitrogen-containing base, and a phosphate group. Different nucleotides join to one another using phosphodiester bonds between the 5’ carbon on one deoxyribose sugar and the 3’ carbon on the next deoxyribose (Cotteril, 1999). New bases are always added at the ...
Read Text
DNA Repair Mechanisms
The paper "DNA Repair Mechanisms" is a delightful example of coursework on biology. The realization of the importance of preservation of genetic integrity is one of the major developments within the field of biomedical genetics over the last several years (Budman & Chu, 2005). Alteration of genetic information has major impacts not only on carcinogenesis but also on aging and other aspects of human health (Leibeling et. al. 2006). Understanding the detailed mechanisms through which genome integrity ...
Read Text
DNA Extraction and PCR of Bird DNA for Sex Identification
The paper “DNA Extraction and PCR of Bird DNA for Sex Identification ” is a persuasive example of a lab report on biology. The methods of collection, storage, and tissue types may affect the quality of DNA. The quality of the starting samples affects the yield and quality of the DNA isolated. The best results can be obtained from fresh material. If the material is not used immediately, it can be frozen immediately in a mixture of ethanol and dry ice or in liquid nitrogen and stored at ...
Read Text
DNA Typing and Genetic Mapping
The paper "DNA Typing and Genetic Mapping" is a wonderful example of an assignment on biology. DNA profiling also termed as DNA testing, DNA typing or genetic fingerprinting can be described as a technique used in forensic science and normally it is usually used by forensic scientists in identifying individuals as per their respective DNA profiles. Normally the DNA profiles are usually recorded in sets of numbers which is a real sense reflect a particular individual’s DNA makeup and sometimes ...
Read Text
Contact Us