Archetype Essays: Free Topic, Sample and Examples

Current Psychological Phenomenons That Are Tied To The History Of Psychology
Psychological Phenomena: ParaeidoliaHuman beings are capable of seeing patterns and shapes, which they regard as meaningful in the natural world that is around them. Many when they look at the clouds claim to see a face or religious symbols in any shape for instance a rock. In history this shapes seen in the natural objects were known as Lus Naturae or jokes of nature. This was a deep belief of the medieval naturalists that nature jokes around human by placing shapes such as faces in objects for ...
Read Text
Effects of Post-Secondary Education
The paper "Effects of Post-Secondary Education" is an outstanding example of an education essay. Post-Secondary education has been considered both advantageous and disadvantageous according to the perception of many people. Every individual tends to think that their view is concerning post-secondary education that people are subjected to after secondary education. Apparently, this takes different views since human ideas are always diverse even if some factors are kept at constant. Colleges and universities ...
Read Text
Anthony Vidlers Third Typology
The paper "Anthony Vidler’s Third Typology" is a great example of a literature review on architecture. Typological thoughts, according to Yasemin (2007), are a way of thinking that does refer to neither age nor place. Anthony Vidler’s essay, “The Third Typology,” introduces the reader to a series of subsequent typologies in history that serves to legitimize the evolution of architecture. In keeping with Vidler, the initial typology emerged at the same time with Newton’s ...
Read Text
You Don't Mess with the Zohan by Adam Sandler
The paper “You Don’t Mess with the Zohan by Adam Sandler”  is a breathtaking version of a movie review on gender & sexual studies. The term Heterosexuality refers to the sexual orientation of human beings towards the opposite sex. It refers to the romantic and sexual appeal people feel towards the opposite sex with a feeling of a sense of belongingness and social identity based on these feelings. Heterosexuality is a term given to human beings' sexual behavior but could ...
Read Text
Screen Diary
Screen Diary2006Un Chien Andalou (1929) by Luis BunuelUn Chien Andalou (An Andalusian Dog) was Luis Bunuel’s first film, one that he scripted along with the surrealist painter, Salvador Dali. Both Bunuel and Dali were young men then and wanted to break away from the avant-garde genre of artistic films that had become popular with the French bourgeois society. The main trait of surrealism, a genre that painters like Dali continued to use in their paintings even later, was its deliberate attempt to ...
Read Text
Project Management for Business, Engineering, and Technology
The paper “Project Management for Business, Engineering, and Technology” is a potent example of an essay on information technology. The project analyzed in this essay was intended to provide software that would enable consumers, retailers, and dealers to access online reservations to hotels, cars, and air tickets. Six people drawn from the student participants and personnel from the client company made up the work team. Managers are responsible for providing direction and overseeing the ...
Read Text
INTRODUCTION TO SOCIAL & CULTURAL STUDIES: IDENTITIES
Feminine IdentitiesWomen today must face the issue of their own authority. We live in explosive times when traditional models for women no longer hold. New models are insistently foisted upon us from every side. The bewildering variety threatens us. We are told that we must recognize ourselves as androgynous, or that a lesbian life really is a valid life-style, or that we must not be duped by any of these new ideas but implant old-fashioned motherhood in ourselves. Or we must strike out for a career ...
Read Text
Ethan Frome's Story Interpretation like a Fairy Tale due to His Archetypes
The paper "Ethan Frome's Story Interpretation like a Fairy Tale due to His Archetypes" is a great example of an annotated bibliography on literature. Ammons, Elizabeth. “Elizabeth Ammons on Ethan Frome as a Fairy Tale.” Blooms Major Novelists: Edith Wharton (2002): 48-50.Web. 29 Nov. 2011. Literary Reference Center.Ammons argues that Ethan Frome can be interpreted as a fairy tale because the novel depicts the archetypes of “the witch, the silvery maiden, the honest woodcutter” ...
Read Text
Halloween in American Culture
The paper "Halloween in American Culture " is an excellent example of a term paper on culture. The Halloween holiday has its origins from a pagan holiday that served to honor the dead, known as All Hallows Eve. This dates back to the 5th century BC in Celtic Ireland; it was believed that disembodied spirits of the dead would return in search of living bodies to possess, and this act was seen as their only hope for an afterlife. In addition, it is believed that Halloween has its share of influence ...
Read Text
Joseph Campbell's Life and Work, Highlighting the Role of the Myths, the Artists and the Ritual
The paper "Joseph Campbell's Life and Work, Highlighting the Role of the Myths, the Artists and the Ritual" is a good example of an annotated bibliography on literature. Bloom, Harold, and Blake Hobby. The Heros Journey Edited And With An Introduction by Harold Bloom; Volume Editor, Blake Hobby. n.p.: New York: Blooms Literary Criticism, c2009., 2009. OhioLINK Library Catalog – LR. Web. 19 June 2014. This book also addresses the works of Joseph Campbell by developing a close analysis of Campbell’s ...
Read Text
The Role of Nature and Nurture in Human Development
The paper "The Role of Nature and Nurture in Human Development" is an outstanding example of an assignment on social science. The roles of nature and nurture in the development of a human being have each been given credence throughout the history of psychology. Nature is used to refer to the biologically encoded (genetic) dominance over the emergence of human behavior. In contrast, nurture is the environmental impact on behavior, including physical and social sources. These concepts have caused many ...
Read Text
Movement Analysis in Dirty Dance
The paper "Movement Analysis in Dirty Dance" is an excellent example of a movie review on visual arts and film studies. Dirty Dance is a form of dance that emerged in the late half of the seventies and the first half of the eighties. This dance - form involves close dance movements based on the archetypal body moves of Salsa but not exactly similar to it. The dance is all about connections and the dancing partners share a close connection during the dance.Based on this dance - form and inspired ...
Read Text
The Small-Pox by Lady Mary Wortley Montagu
The paper “The Small-Pox by Lady Mary Wortley Montagu" is an exciting example of a book review on literature. The poem describes the consequence of the disease of smallpox and its impact on the appearance of the speaker who is a woman named Flavia. In the first stanza, the condition of Flavia is described as wretched as she is suffering from smallpox and therefore incurred the ugly marks that render shame to her and prevents her from looking at the mirror. Her mind is ‘wounded’ ...
Read Text
Close Reading A Poem And Thesis-driven Essay
The Love Song of J. Alfred Prufrock In the poem ‘The Love Song of J. Alfred Prufrock’, T.S Eliot presents a unique examination of the anguished psyche of an archetypal modern man who is overeducated, neurotic, eloquent, and emotionally stilted. The poem’s speaker, Prufrock, seems to be speaking to a potential lover whom he desires to consummate a relationship with. Despite the comments that his friend make about his inadequacies, he does not dare to make a deft approach the lady since he knows too ...
Read Text
Geometric Design
The paper "Geometric Design" is a wonderful example of an assignment on design and technology. The origin function of Navajo of weaving was to produce clothing, with designs of shoulder robes, rectangular panel or wrap around dresses, semi-tailored shirts and designs of different kind of belts. The weaving began in the mid-1800s during the trade with the white settlers. Same designs have been developed and improved geometrically to assist in mathematical fields. The woven designs that were developed ...
Read Text
Landscape Architects: A Biographical Profile
The paper "Landscape Architects: A Biographical Profile" is a g4eat example of a term paper on architecture. 1.1 Biographic information about the person (Diana Balmori) you are researching: no more than one page. Diana Balmori was born on 6th April 1932. She is an internationally renowned landscape and urban designer. She is one of the world’s leading and most innovative landscape architects in the field of urban design. She is also the founder of the landscape design firm known as Balmori ...
Read Text
Memory Management - Virtual Memory with Paging and Segmentation
The paper “Memory Management - Virtual Memory with Paging and Segmentation” is an exciting example of a literature review on information technology. Memory paging according to Dhamdhere (2006) is a management method for memory for managing how resources of virtual machines or computer memory are shared. Basically, a PC can address memory above the amount set up on the computer. Dhamdhere affirms that this memory that is nonphysical, commonly regarded as virtual memory, is in fact a hard ...
Read Text
Should Feminists Promote Women's Rights As Human Rights
Should Feminists Promote Women’s Rights as Human Rights?IntroductionThis essay reflects on the question should feminists promote women’s rights as human rights? While women generally have been able to raise the human rights machinery when they find themselves in situations as such, some of their gender experiences of human rights such as abuse and rape in detention undoubtedly have not been quite visible within the established definitions of abuse (Cook 1994, p.76). This is precisely because women ...
Read Text
Child Abuse as a Social Issue
The paper "Child Abuse as a Social Issue" is a good example of a literature review on social science. The way childhood is constructed in society today follows a line of path dependency from a dominant neo-liberalist discourse. Such supranational institutions are male constructed and there is an unequal power relation going through these structures. Childhood is a status acknowledged universally by many and throughout history, there have been calls for adults to protect children from harm. There ...
Read Text
The Nucleotide Sequence of DNA, Introns & Exons, Restriction Enzymes, Intron-Exon Evolution, cDNA Sequencing, Estimating Gene
The paper “The Nucleotide Sequence of DNA, Introns & Exons, Restriction Enzymes, Intron-Exon Evolution, cDNA  Sequencing, Estimating Gene Numbers” is a meaty example of an assignment on biology. A dideoxynucleotide sequencing gel obtained from the beginning of a certain DNA segment is shown below. The nucleotide sequence of this DNA section is 5’GAACATCAGGATCGTACCAGGGTAA3’ .2INTRONS & EXONS(note: single loop lying under molecule shown)(a) According to the figure, ...
Read Text
Contact Us